Review




Structured Review

Addgene inc isce1
Isce1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 293 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcbascei+plasmid/pCBASceI+(Plasmid+%2326477)/pm41888115-322-40-41
Average 96 stars, based on 293 article reviews
isce1 - by Bioz Stars, 2026-10
96/100 stars

Images

Related Articles

Non-Homologous End Joining:

Article Title: LINC01235 Promotes Clonal Evolution through DNA Replication Licensing-Induced Chromosomal Instability in Breast Cancer.
Article Snippet: DNA reporter cells were constructed by infection cells with pLCN DSB Repair Reporter (addgene, 98 895) with G418 selection for one month until killing control was all dead. .. For the NHEJ DNA repair assay, one million cells containing integrated reporter were transfected with 2.5 μg of pCBASceI plasmid (addgene, 26 477). .. For HR DNA repair reporter analysis, one million cells containing integrated reporter were transfected with 4 μg of pCAGGS-DRR-mCherry plasmid (addgene, 98 896) and 2.5 μg of pCBASceI plasmid (addgene, 26 477).

Article Title: LINC01235 Promotes Clonal Evolution through DNA Replication Licensing‐Induced Chromosomal Instability in Breast Cancer
Article Snippet: DNA reporter cells were constructed by infection cells with pLCN DSB Repair Reporter (addgene, 98 895) with G418 selection for one month until killing control was all dead. .. For the NHEJ DNA repair assay, one million cells containing integrated reporter were transfected with 2.5 μg of pCBASceI plasmid (addgene, 26 477). .. For all the experiments that need cell cycle analysis, cells were washed twice with Perm buffer and stained with propidium iodide (Thermo, P3566) + RNase A at room temperature for 15 min. After washing twice with FACS buffer, the samples were analyzed on CytoFLEX Flow Cytometer, and data analysis was conducted with the FlowJo software.

Transfection:

Article Title: LINC01235 Promotes Clonal Evolution through DNA Replication Licensing-Induced Chromosomal Instability in Breast Cancer.
Article Snippet: DNA reporter cells were constructed by infection cells with pLCN DSB Repair Reporter (addgene, 98 895) with G418 selection for one month until killing control was all dead. .. For the NHEJ DNA repair assay, one million cells containing integrated reporter were transfected with 2.5 μg of pCBASceI plasmid (addgene, 26 477). .. For HR DNA repair reporter analysis, one million cells containing integrated reporter were transfected with 4 μg of pCAGGS-DRR-mCherry plasmid (addgene, 98 896) and 2.5 μg of pCBASceI plasmid (addgene, 26 477).

Article Title: Repression of PFKFB3 sensitizes ovarian cancer to PARP inhibitors by impairing homologous recombination repair.
Article Snippet: .. In brief, control, PFKFB3-KD SKOV3 and OVCAR8 cells were transfected with 1 μg of pDRGFP (Addgene, 26,475) along with 0.75 μg of pCBASceI plasmid (Addgene, 26,477). .. Following a 48 h incubation period post-transfection, the cells were collected for analysis using a BD FACScan flow cytometry system (Becton Dickinson, Franklin, NJ, USA).

Article Title: NSUN2 facilitates DICER cleavage of DNA damage-associated R-loops to promote repair
Article Snippet: .. After 24 h cells were seeded and forward transfected with pCBASceI plasmid (Addgene #26477) and Lipofectamine 3000. .. After 48 h, cells were trypsinised and resuspended with 10%FBS in PBS before running FACS. siRAD51 was used as positive control for HeLa HR reporter cells; the DNA-PK inhibitor Wortmannin (Sigma, W3144-250UL, 1 μM for 6 h) was used as the positive control for HeLa NHEJ reporter cells.

Article Title: LINC01235 Promotes Clonal Evolution through DNA Replication Licensing‐Induced Chromosomal Instability in Breast Cancer
Article Snippet: DNA reporter cells were constructed by infection cells with pLCN DSB Repair Reporter (addgene, 98 895) with G418 selection for one month until killing control was all dead. .. For the NHEJ DNA repair assay, one million cells containing integrated reporter were transfected with 2.5 μg of pCBASceI plasmid (addgene, 26 477). .. For all the experiments that need cell cycle analysis, cells were washed twice with Perm buffer and stained with propidium iodide (Thermo, P3566) + RNase A at room temperature for 15 min. After washing twice with FACS buffer, the samples were analyzed on CytoFLEX Flow Cytometer, and data analysis was conducted with the FlowJo software.

Article Title: Targeted inhibition of the CREB1-CtIP axis enhances the efficacy of abiraterone combined with radiotherapy in prostate cancer.
Article Snippet: .. In brief, cells were transfected with pLCN DSB Repair Reporter (Addgene plasmid #98895), pCAGGS DRR mCherry Donor EF1a BFP (Addgene plasmid #98896), and pCBASceI plasmid (Addgene plasmid #26477) for 72 h before fluorescence-activated cell sorting analysis (these plasmids were gifts from Jan Karlseder). .. Finally, samples were mounted with antifade medium and imaged using a LSM 880 laser scanning confocal microscope (Carl Zeiss, Germany).

Article Title: LINC01235 Promotes Clonal Evolution through DNA Replication Licensing-Induced Chromosomal Instability in Breast Cancer.
Article Snippet: For the NHEJ DNA repair assay, one million cells containing integrated reporter were transfected with 2.5 μg of pCBASceI plasmid (addgene, 26 477). .. For HR DNA repair reporter analysis, one million cells containing integrated reporter were transfected with 4 μg of pCAGGS-DRR-mCherry plasmid (addgene, 98 896) and 2.5 μg of pCBASceI plasmid (addgene, 26 477). ..

Plasmid Preparation:

Article Title: LINC01235 Promotes Clonal Evolution through DNA Replication Licensing-Induced Chromosomal Instability in Breast Cancer.
Article Snippet: DNA reporter cells were constructed by infection cells with pLCN DSB Repair Reporter (addgene, 98 895) with G418 selection for one month until killing control was all dead. .. For the NHEJ DNA repair assay, one million cells containing integrated reporter were transfected with 2.5 μg of pCBASceI plasmid (addgene, 26 477). .. For HR DNA repair reporter analysis, one million cells containing integrated reporter were transfected with 4 μg of pCAGGS-DRR-mCherry plasmid (addgene, 98 896) and 2.5 μg of pCBASceI plasmid (addgene, 26 477).

Article Title: Repression of PFKFB3 sensitizes ovarian cancer to PARP inhibitors by impairing homologous recombination repair.
Article Snippet: .. In brief, control, PFKFB3-KD SKOV3 and OVCAR8 cells were transfected with 1 μg of pDRGFP (Addgene, 26,475) along with 0.75 μg of pCBASceI plasmid (Addgene, 26,477). .. Following a 48 h incubation period post-transfection, the cells were collected for analysis using a BD FACScan flow cytometry system (Becton Dickinson, Franklin, NJ, USA).

Article Title: NSUN2 facilitates DICER cleavage of DNA damage-associated R-loops to promote repair
Article Snippet: .. After 24 h cells were seeded and forward transfected with pCBASceI plasmid (Addgene #26477) and Lipofectamine 3000. .. After 48 h, cells were trypsinised and resuspended with 10%FBS in PBS before running FACS. siRAD51 was used as positive control for HeLa HR reporter cells; the DNA-PK inhibitor Wortmannin (Sigma, W3144-250UL, 1 μM for 6 h) was used as the positive control for HeLa NHEJ reporter cells.

Article Title: PARP1 and PARP2 are dispensable for DNA repair by microhomology-mediated end-joining during mitosis
Article Snippet: .. The ISceI-BFP plasmid to cut the MMEJ reporter was derived from the pCBASceI plasmid (Addgene #26477) in which nucleotides 1730-2587 have been replaced by codon optimized ISceI-T2A-BFP. .. The Cas9-GFP plasmid to cut the MMEJ reporter was derived from pSpCas9(BB)-2A-GFP plasmid (Addgene #48138), and golden gate was used to insert either the non-targeting guide (CTCGACAGTTCGTCCCGAGC) or a guide against the MMEJ reporter (CTGCAAGATTAGGGATAACA).

Article Title: LINC01235 Promotes Clonal Evolution through DNA Replication Licensing‐Induced Chromosomal Instability in Breast Cancer
Article Snippet: DNA reporter cells were constructed by infection cells with pLCN DSB Repair Reporter (addgene, 98 895) with G418 selection for one month until killing control was all dead. .. For the NHEJ DNA repair assay, one million cells containing integrated reporter were transfected with 2.5 μg of pCBASceI plasmid (addgene, 26 477). .. For all the experiments that need cell cycle analysis, cells were washed twice with Perm buffer and stained with propidium iodide (Thermo, P3566) + RNase A at room temperature for 15 min. After washing twice with FACS buffer, the samples were analyzed on CytoFLEX Flow Cytometer, and data analysis was conducted with the FlowJo software.

Article Title: Targeted inhibition of the CREB1-CtIP axis enhances the efficacy of abiraterone combined with radiotherapy in prostate cancer.
Article Snippet: .. In brief, cells were transfected with pLCN DSB Repair Reporter (Addgene plasmid #98895), pCAGGS DRR mCherry Donor EF1a BFP (Addgene plasmid #98896), and pCBASceI plasmid (Addgene plasmid #26477) for 72 h before fluorescence-activated cell sorting analysis (these plasmids were gifts from Jan Karlseder). .. Finally, samples were mounted with antifade medium and imaged using a LSM 880 laser scanning confocal microscope (Carl Zeiss, Germany).

Article Title: LINC01235 Promotes Clonal Evolution through DNA Replication Licensing-Induced Chromosomal Instability in Breast Cancer.
Article Snippet: For the NHEJ DNA repair assay, one million cells containing integrated reporter were transfected with 2.5 μg of pCBASceI plasmid (addgene, 26 477). .. For HR DNA repair reporter analysis, one million cells containing integrated reporter were transfected with 4 μg of pCAGGS-DRR-mCherry plasmid (addgene, 98 896) and 2.5 μg of pCBASceI plasmid (addgene, 26 477). ..

Control:

Article Title: Repression of PFKFB3 sensitizes ovarian cancer to PARP inhibitors by impairing homologous recombination repair.
Article Snippet: .. In brief, control, PFKFB3-KD SKOV3 and OVCAR8 cells were transfected with 1 μg of pDRGFP (Addgene, 26,475) along with 0.75 μg of pCBASceI plasmid (Addgene, 26,477). .. Following a 48 h incubation period post-transfection, the cells were collected for analysis using a BD FACScan flow cytometry system (Becton Dickinson, Franklin, NJ, USA).

Derivative Assay:

Article Title: PARP1 and PARP2 are dispensable for DNA repair by microhomology-mediated end-joining during mitosis
Article Snippet: .. The ISceI-BFP plasmid to cut the MMEJ reporter was derived from the pCBASceI plasmid (Addgene #26477) in which nucleotides 1730-2587 have been replaced by codon optimized ISceI-T2A-BFP. .. The Cas9-GFP plasmid to cut the MMEJ reporter was derived from pSpCas9(BB)-2A-GFP plasmid (Addgene #48138), and golden gate was used to insert either the non-targeting guide (CTCGACAGTTCGTCCCGAGC) or a guide against the MMEJ reporter (CTGCAAGATTAGGGATAACA).

other:

Article Title: LINC01235 Promotes Clonal Evolution through DNA Replication Licensing‐Induced Chromosomal Instability in Breast Cancer
Article Snippet: For all the experiments that need cell cycle analysis, cells were washed twice with Perm buffer and stained with propidium iodide (Thermo, P3566) + RNase A at room temperature for 15 min. After washing twice with FACS buffer, the samples were analyzed on CytoFLEX Flow Cytometer, and data analysis was conducted with the FlowJo software.

Fluorescence:

Article Title: Targeted inhibition of the CREB1-CtIP axis enhances the efficacy of abiraterone combined with radiotherapy in prostate cancer.
Article Snippet: .. In brief, cells were transfected with pLCN DSB Repair Reporter (Addgene plasmid #98895), pCAGGS DRR mCherry Donor EF1a BFP (Addgene plasmid #98896), and pCBASceI plasmid (Addgene plasmid #26477) for 72 h before fluorescence-activated cell sorting analysis (these plasmids were gifts from Jan Karlseder). .. Finally, samples were mounted with antifade medium and imaged using a LSM 880 laser scanning confocal microscope (Carl Zeiss, Germany).

FACS:

Article Title: Targeted inhibition of the CREB1-CtIP axis enhances the efficacy of abiraterone combined with radiotherapy in prostate cancer.
Article Snippet: .. In brief, cells were transfected with pLCN DSB Repair Reporter (Addgene plasmid #98895), pCAGGS DRR mCherry Donor EF1a BFP (Addgene plasmid #98896), and pCBASceI plasmid (Addgene plasmid #26477) for 72 h before fluorescence-activated cell sorting analysis (these plasmids were gifts from Jan Karlseder). .. Finally, samples were mounted with antifade medium and imaged using a LSM 880 laser scanning confocal microscope (Carl Zeiss, Germany).



Similar Products

96
Addgene inc isce1
Isce1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcbascei+plasmid/pCBASceI+(Plasmid+%2326477)/pm41888115-322-40-41
Average 96 stars, based on 1 article reviews
isce1 - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

96
Addgene inc pcbascei plasmid
Pcbascei Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcbascei+plasmid/pCBASceI+(Plasmid+%2326477)/pm41912484-168-23-25
Average 96 stars, based on 1 article reviews
pcbascei plasmid - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

96
Addgene inc pcbasce plasmid
Pcbasce Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcbascei+plasmid/pCBASceI+(Plasmid+%2326477)/pm41826730-92-9-12
Average 96 stars, based on 1 article reviews
pcbasce plasmid - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

96
Addgene inc dual luciferase reporter
Dual Luciferase Reporter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcbascei+plasmid/pCBASceI+(Plasmid+%2326477)/pm41735318-283-0-19
Average 96 stars, based on 1 article reviews
dual luciferase reporter - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

96
Addgene inc dna repair reporter plasmids65
Dna Repair Reporter Plasmids65, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcbascei+plasmid/pCBASceI+(Plasmid+%2326477)/pm41735318-283-9-19
Average 96 stars, based on 1 article reviews
dna repair reporter plasmids65 - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

96
Addgene inc i scei expression plasmid
I Scei Expression Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcbascei+plasmid/pCBASceI+(Plasmid+%2326477)/bio_rxiv__64898__2026__02__17__706442-228-11-14
Average 96 stars, based on 1 article reviews
i scei expression plasmid - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

96
Addgene inc i scei expression vector pcbascei
I Scei Expression Vector Pcbascei, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcbascei+plasmid/pCBASceI+(Plasmid+%2326477)/pm41687404-83-14-18
Average 96 stars, based on 1 article reviews
i scei expression vector pcbascei - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

96
Addgene inc i scei endonuclease expression vector
I Scei Endonuclease Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcbascei+plasmid/pCBASceI+(Plasmid+%2326477)/pm41611070-71-6-10
Average 96 stars, based on 1 article reviews
i scei endonuclease expression vector - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

Image Search Results